Routes Update

Of interest to those of you following the Channel 4/Wellcome Trust game at www.routesgame.com, not only is there a documentary to follow and flash games to play (and playstations to be won), but there is also an ARG lurking in the background. See the Unforum thread, the catch up videos and Matt Blacker and Rachel Bickles' blogs (they're a rookie journalist and professional niece respectively, investigating Markus Schoenberg's mysterious death in Peru. Yes, Peru) to find out what's going on. The catch up videos should be enough if you just want to dip in to it.

In my last post I described how I stumbled across (all on my ownsome) a way to access the police files on Schoenberg's death. Some people (hi Zoe!) have had problems accessing the images so I've uploaded them to flickr here in no particular order.

In doing so three images in particular caught my eye, partly becuase they're notes written in the same type of moleskine pad that I have (the squared one - love it) and partly because I spotted some familiar bits and pieces.

On one there is one (or a couple of?) DNA sequences


The sequences as two strings are:

TCGACGGGGCGTTATAATGAAGAGGATTCTTTGGAAGGCGCGCTATGTCTTGAGGCTAGAGCGAACTGTGAGTGA
CCTCGTATCGAATCCGGGCTTATATGTATCACCGGGARRTTGGACAACTGA

The first thing I'm tempted to do with a DNA sequence is to see what it is - I BLASTed it (a biological search algorithm) against the public sequence databases at the NCBI and got nothing. The second thing that I was tempted to do was to translate the DNA sequence into a protein sequence, each three letters in the DNA sequence represent one amino acid and there is a letter code used to represent each amino acid. You can do this for yourself here at ExPASy, copy and paste the sequence above and hit translate. You get six protein sequences back because with DNA sequences you can't always be sure whether the codons start at the first, second or third letter of the sequence and you don't know whether you should be reading forwards or backwards. For a table to do the same thing manually check out wikipedia here.

Anyway - this one's easy, it's forwards and the first DNA letter (I'm going to start calling them bases because it feels patronising calling them letters) is the start of the codon:

S T G R Y N E E D S L E G A L C L E A R A N C E Stop P R I E S G L I C I T G X L D N Stop

Certain things leap out: Stgry Needs Legal Clearance - Stingray needs legal clearance perhaps (because I like supermarionation); the two sentences are both ended by stop codons (TGA - oh yes, your DNA sequence even has punctuation) which is nice; and the second sentence makes less sense.

I thought that it might be in a different frame (the codons starting on the second or third base) but when you look at the other possible translations they make less sense (no nice neat stop codon at the end). I'm also intrigued by the X. X doesn't represent a particular amino acid and it's in there because ExPASy couldn't translate the codon ARR, which is fair enough because R isn't in DNA, it's an IUPAC ambiguity code - a fancy arsed way of saying "we're not sure whether this is an A or a G, but it's definitely one or the other". So ARR could be AAG, AGA, AAA or AGG, tranlsating that to protein there are only two options, L or K. Neither make any more sense. LDN at the end suggests London to me, but in what context? There are 323 anagrams of P R I E S G L I C I T G X L D N, none of which leap at me. I have a feeling there is more decrypting to be done to that part of the message, but I haven't got it yet. Tish.

Still, it's a start and Markus is egging us on - one of the notes on another page is "*idea* messages within life". The same page also references Craig Venter (coincidentally, I've blogged about him before) - I have a feeling that he's mentioned in order to reference his work on synthetic biology, building organisms (specifically bacteria in the first instance) from scratch for particular purposes, such as fuel production.

Crime scene, mug shots and translations

I'm good - so very good at cracking passwords. But only when they're the name of someone's son. The investigation into the death of Routes adviser Markus Schoenberg is hotting up - and we can now see the case files for the Calca Police investigation by putting in the the case file number: CLC0108-1314, investigating officer's name: cbarrera and using his son's name as password: rafael. I fired off a quick email to Matt Blacker to let him know.

The case files include crime scene photos, mug shots, the correspondence from the police with the UK and also a ton of interview to translate. All good fun. Particularly the mug shots - nasty looking bunch. Updates here.

I'm not convinced that Schoenberg was really a "biopirate" - it just seems out of character. However his death is certainly suspicious, hopefully these files will provide some clarity.

Open Access Commenting - An Opportunity.

Open Access publishing is a Very Good Thing. It's a model of publishing scientific journals where, rather than having to pay for access and running the lottery of whether your institution library has a subscription, whether you're on the right internet connection or you picked the right publisher to link to a journal through, the article is freely available at a click. It's freely available because the author of the article has coughed up a fee (several hundred to a couple of thousand dollars/pounds/euros) when they had it accepted in the journal. Funders of research are cottoning on to the fact that if they give the scientists a bit of money to pay this fee then open access means more people can see the research and they get a bit more kudos too. Everyone's a winner.

There's a list of open access journals at the wittily named Directory of Open Access & Hybrid Journals, but the two big names are BioMed Central and Public Library of Science. Both offer open access (BMC started doing so a little before PLoS, though PLoS is exclusively open access), and both charge fees for publishing; BMC is for-profit and PLoS not. Open access has also resulted in more experimentation with the standard publishing model - some journals allow reviewers of manuscripts to make their comments public (also a Very Good Thing - it hopefully stops the venting of frustrations that some reviewers seem to relish - Environmental Microbiology publishes select examples of these in their Christmas issue, which is a good laugh for everyone except the poor person at the bench who had their next grant riding on the publication) and even allow comments from readers. PLoS One has taken this the furthest, where commenting on papers can be located to specific items within the text.

It's this that's really interesting. Allowing readers to comment on papers adds a lot of value to them; other scientists might ask for clarification of points, suggest contrasting views, or develop collaborations. The article potentially becomes the start of a debate leading to further findings - how exciting! Only, in reality, this doesn't really happen. According to research available at Nascent (a blog from the publisher Nature - note, not an open access publisher) BioMed Central articles, between November 2002 and January 2008 managed 945 comments. By my reckoning that's about 3 comments a week shared between all these journals. Lordy! They must smell bad. Something for rivals PLoS to crow about? Not really, they have the same problem and Nascent is soliciting help from people to categorise PLoS's comments in the same way as they did for BMC.

But why is this the case?

Any one journal article is going to have a small pool of interested people - research is incremental and takes place in little niches, occasionally research has impact outside its own niche and that's probably when you would get more comments. The Nascent article doesn't correlate number of comments by impact of the paper.

Comments are more formal than in other places where users can leave comments and require more careful formulation - YouTube for example. The top three comments on the current most viewed vid are "omg, brilliant!!!!!","man u r craz" and "Awsome!" Not the sort of comment you're likely to get at BMC as scientists talk to each other in a different way and are likely to be judged by the authors on the quality of their comment. Though I know plenty of researchers are thinking "that tedious old ham has been churning out the same old crap for years" they're unlikely to say that to the author's faces. Mostly. A large number of the comments are actually from the authors themselves, adding additional reference material or acknowledgements - a nice thing to be able to do.

The reality of the situation is that you're not going to get many comments on journal articles and actually, it doesn't matter. One thing the Nascent article does conclude is that the comments generally improve the value of the article they're left on. Even if that happens on only one or two articles, it has justified the inclusion of a commenting mechanism. Also, it's likely to get steadily better, scientists are a recalcitrant bunch for people who are supposed to be at the cutting edge of knowledge, they have a lot of inertia when it comes to change.

However, I think the publishers are missing a trick. Commenting mechanisms would be a great tool for public engagement. Let's compare that youtube video again to a random paper from PLoS (OK, I admit it's not entirely random, I know some stuff about probiotics). Quite a lot of people like listening to music, quite a lot also like classical music, many can appreciate the skill in video-editing, guitar-playing and one or two might think he's silly for wearing that hat (not me of course - my hairline's receding and shortly I will be wearing a hat whenever I'm in public). Our random paper is about probiotics, you can buy them in the supermarket and quite a few people down them regularly, they improve the health of your digestive systems (well, some do, some don't, it's complicated). It's also about inflammatory bowel disease; most people with internet access also have a bowel, 1 in 400 people in the UK have IBD and the figure is similarly high in the US. That's a lot of vested interest. Scientific language is complicated, and deliberately so - complicated concepts have to be conveyed unambiguously to allow the sharing of research with other scientists, but it also creates a barrier to those that have never heard of subepithelial cells or mucosa.

If publishers encouraged (or even required?) authors to produce a peer-reviewed, lay summary of the work in the paper and then allowed general commenting, think of the benefits. The scientists would learn something about public engagement, highlighted as lacking in Robert Winston's recent New Scientist article. The public would be able to see behind the dusty drapes of these massive archives of human knowledge. The two groups might even start to chat about research, its impact and its importance or otherwise.

PLoS and BMC have the tools ready-made for something like this, it'll be interesting to see whether either of them take their publishing one step further.

The things my thesis doesn't say...

I finally completed my PhD thesis in 2005, after starting in 2001. I took the full year to right up, which was silly and self-indulgent of me. I could have completed it in a couple of months if I hadn't kept staring at a blank pages in Word with an even blanker mind. In fact I could have completed it in just the one month had I not used Word at all, particularly the mystifying master document function which, although it allowed you to make a large document with lots of images and format the table of contents and bibliography, this document was a wobbly, paranoid, mental wreck that would crash if there was a slight breeze. Actually, that probably also describes my own state whilst I was writing.

Before I started at Warwick with Colin (noted for being a big name in methane metabolism and having a penchant for Bombay Mix - these facts are unconnected) I was applying for all sorts of PhDs along the theme of quorum sensing - bacterial communication (cool huh?!). Colin was my undergraduate tutor and suggested that I consider a PhD with him as he had a position available that had just been abandoned by the previous applicant. It wasn't in quorum sensing, but it did have a six weeks research cruise in the Arabian Sea associated with it; I was sold. It was still microbial ecology, but that seemed less important than traversing the Indian Ocean, from the Seychelles to Oman, ocasionally filtering water. Brilliant!

My thesis doesn't mention: giant tortoises; smuggled gin disguised as water samples; having my head shaved as we crossed the equator (in a weird "crossing the line ceremony" that seemed to serve only as an excuse for the crew to cross-dress), the day when the salps bloomed and the samples were all fouled with jellies, and catching squid and peeling them for dinner (Nick Fuller particularly enjoyed this, see macabre expression). It doesn't mention the night when we sailed through a Noctiluca bloom, a river of phosphorescent blue algae stretching to the horizon, so bright that we couldn't see where they ended and the stars began. It also doesn't mention the planes going into the twin towers (which we were largely ignorant of, having sporadic access to BBC World Service) or the fact that we were heading into a slightly less than safe patch of water in the Strait of Hormuz - dubbed Exocet Alley in the latter stages of the cruise (at one point I was reassured by a member of the crew that should we be struck by a missile we wouldn't explode, just vanish in a puff of rust - RRS Charles Darwin has since been retired). It doesn't mention colleagues that scream and invent bizarre dance moves, make odd noises when pleased or nervous, that drink the vinegar from pickled-beetroot jars, that are excellent substitutes for professional removals companies or that take pleasure in torturing small stuffed Sesame Street characters (it's difficult to decide whether Grover submerged in liquid nitrogen or Grover with his head sewn on backwards were my particular favourites) or who don't realise that Otis Spunkmeyer muffins shouldn't be abbreviated to just 'spunk' for reasons of decency.



It does mention the fantastic people I got to work with and that supported me in the labs at Warwick and PML, and at home; one reason why I'm making it more available than it currently is (just in the library at Warwick or above my desk). I think it also gives a sense of the difficulties of cross-disciplinary research (I'm no marine chemist), in those thrilling chapters of, if not unsuccesful, certainly tribulation-flavoured science. Aside from that, it's here for self-promotion and so I can sit secure in the knowledge that should I lose every copy, it might be lurking somewhere on the internet.

There are three important parts to read: the dedication on page ii; the acknowledgements on page xi; every sweat-soaked, brain-numbing, agony-inducing last word. I wept blood over this thing for four years! I know the plot's not thrilling and the finale is limp, but you can spare ten minutes to scan it can't you? There's pictures?

Marine Methyl Halide Utilising Bacteria

Publish at Scribd or explore others: Theses Academic Work bacterial diversity gas chromatography