Routes Update

Of interest to those of you following the Channel 4/Wellcome Trust game at www.routesgame.com, not only is there a documentary to follow and flash games to play (and playstations to be won), but there is also an ARG lurking in the background. See the Unforum thread, the catch up videos and Matt Blacker and Rachel Bickles' blogs (they're a rookie journalist and professional niece respectively, investigating Markus Schoenberg's mysterious death in Peru. Yes, Peru) to find out what's going on. The catch up videos should be enough if you just want to dip in to it.

In my last post I described how I stumbled across (all on my ownsome) a way to access the police files on Schoenberg's death. Some people (hi Zoe!) have had problems accessing the images so I've uploaded them to flickr here in no particular order.

In doing so three images in particular caught my eye, partly becuase they're notes written in the same type of moleskine pad that I have (the squared one - love it) and partly because I spotted some familiar bits and pieces.

On one there is one (or a couple of?) DNA sequences


The sequences as two strings are:

TCGACGGGGCGTTATAATGAAGAGGATTCTTTGGAAGGCGCGCTATGTCTTGAGGCTAGAGCGAACTGTGAGTGA
CCTCGTATCGAATCCGGGCTTATATGTATCACCGGGARRTTGGACAACTGA

The first thing I'm tempted to do with a DNA sequence is to see what it is - I BLASTed it (a biological search algorithm) against the public sequence databases at the NCBI and got nothing. The second thing that I was tempted to do was to translate the DNA sequence into a protein sequence, each three letters in the DNA sequence represent one amino acid and there is a letter code used to represent each amino acid. You can do this for yourself here at ExPASy, copy and paste the sequence above and hit translate. You get six protein sequences back because with DNA sequences you can't always be sure whether the codons start at the first, second or third letter of the sequence and you don't know whether you should be reading forwards or backwards. For a table to do the same thing manually check out wikipedia here.

Anyway - this one's easy, it's forwards and the first DNA letter (I'm going to start calling them bases because it feels patronising calling them letters) is the start of the codon:

S T G R Y N E E D S L E G A L C L E A R A N C E Stop P R I E S G L I C I T G X L D N Stop

Certain things leap out: Stgry Needs Legal Clearance - Stingray needs legal clearance perhaps (because I like supermarionation); the two sentences are both ended by stop codons (TGA - oh yes, your DNA sequence even has punctuation) which is nice; and the second sentence makes less sense.

I thought that it might be in a different frame (the codons starting on the second or third base) but when you look at the other possible translations they make less sense (no nice neat stop codon at the end). I'm also intrigued by the X. X doesn't represent a particular amino acid and it's in there because ExPASy couldn't translate the codon ARR, which is fair enough because R isn't in DNA, it's an IUPAC ambiguity code - a fancy arsed way of saying "we're not sure whether this is an A or a G, but it's definitely one or the other". So ARR could be AAG, AGA, AAA or AGG, tranlsating that to protein there are only two options, L or K. Neither make any more sense. LDN at the end suggests London to me, but in what context? There are 323 anagrams of P R I E S G L I C I T G X L D N, none of which leap at me. I have a feeling there is more decrypting to be done to that part of the message, but I haven't got it yet. Tish.

Still, it's a start and Markus is egging us on - one of the notes on another page is "*idea* messages within life". The same page also references Craig Venter (coincidentally, I've blogged about him before) - I have a feeling that he's mentioned in order to reference his work on synthetic biology, building organisms (specifically bacteria in the first instance) from scratch for particular purposes, such as fuel production.